View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11058_low_21 (Length: 254)
Name: NF11058_low_21
Description: NF11058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11058_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 31911931 - 31912173
Alignment:
| Q |
1 |
caagttcatgcgcgtgtttttattgatggttttgaattcgaacaagacaaggttttgtgtagttcgatagttaatttttatgggaaatgtggtgatttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31911931 |
caagttcatgcgcgtgtttttattgatggttttgaattcgaacaagacaaggttttgtgtagttcgatagttaatttttatgggaaatgtggtgatttgg |
31912030 |
T |
 |
| Q |
101 |
atagtgctgctcgggtcgtgggttttgtgaaggaagttgatgatttttctttatctgctttggtatcgggttatgcaaatgccggtagaatgagtgatgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31912031 |
atagtgctgctcgggtcgtgggttttgtgaaggaagttgatgatttttctttatctgctttggtatcgggttatgcaaatgccggtagaatgagtgatgc |
31912130 |
T |
 |
| Q |
201 |
aagaaaggtttttgataacaaggttgatccttgttctgtgctg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31912131 |
aagaaaggtttttgataacaaggttgatccttgttctgtgctg |
31912173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 40651246 - 40651488
Alignment:
| Q |
1 |
caagttcatgcgcgtgtttttattgatggttttgaattcgaacaagacaaggttttgtgtagttcgatagttaatttttatgggaaatgtggtgatttgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40651246 |
caagttcatgcgcgtgtttttattgatggttttgaattcaaacatgacaaggttctgtgtagttcgatagttaatctttatgggaaatgtggtgatttgg |
40651345 |
T |
 |
| Q |
101 |
atagtgctgctcgggtcgtgggttttgtgaaggaagttgatgatttttctttatctgctttggtatcgggttatgcaaatgccggtagaatgagtgatgc |
200 |
Q |
| |
|
||| ||||| | |||| || |||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40651346 |
atattgctgtttgggttgttggttttgtgatggatgttgatgatttttctttatctgctttggtatcgggttatgcaaatgctggtagaatgagtgatgc |
40651445 |
T |
 |
| Q |
201 |
aagaaaggtttttgataacaaggttgatccttgttctgtgctg |
243 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40651446 |
gagaagggtttttgataacaaggttgatccttgttctgtgctg |
40651488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University