View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11058_low_27 (Length: 232)
Name: NF11058_low_27
Description: NF11058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11058_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 93 - 212
Target Start/End: Complemental strand, 18246509 - 18246390
Alignment:
| Q |
93 |
atgcatatggtatatgaaaaccttggatctctctctatcaacacaaactatgttgttgtttcaagtttagacaaagagagtaaaaatagctatgcctata |
192 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
18246509 |
atgcatatggtatatgcagaccttggatctctctctatcaacacaaactatggtgttgtttcaagtttagacaaagagagtaaaaatagctatgccttta |
18246410 |
T |
 |
| Q |
193 |
agagctttgtgatggagaat |
212 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
18246409 |
agagctttgtgatggagaat |
18246390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 10 - 47
Target Start/End: Complemental strand, 18246589 - 18246552
Alignment:
| Q |
10 |
agtgagatgaactcatgatctcttcacaagaaaaccaa |
47 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18246589 |
agtgaaatgaactcatgatctcttcacaagaaaaccaa |
18246552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University