View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11058_low_28 (Length: 231)
Name: NF11058_low_28
Description: NF11058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11058_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 18 - 123
Target Start/End: Complemental strand, 33721089 - 33720985
Alignment:
| Q |
18 |
caattaaatggaaatcaaatggttacctacacttgcnnnnnnnngtgcttggaccttagacgagacaataccgatctcaaccagctagcttaatcaaagg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33721089 |
caattaaatggaaatcaaatggttacctacacttgcaaaaaaa-gtgcttggactttagacgagacaataccgatctcaaccagctagcttaatcaaagg |
33720991 |
T |
 |
| Q |
118 |
tctcaa |
123 |
Q |
| |
|
|||||| |
|
|
| T |
33720990 |
tctcaa |
33720985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University