View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11059_high_10 (Length: 223)
Name: NF11059_high_10
Description: NF11059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11059_high_10 |
 |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 19 - 214
Target Start/End: Complemental strand, 47651297 - 47651102
Alignment:
| Q |
19 |
actaaaaggggaagaattaagtattaatgtaacaaatttgtccgtttaatgttttgtggtgactgtggtttggttatgtctgggggttctggccttgggt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47651297 |
actaaaaggggaagaattaagtattaatgtaacaaatttgtccgtttaatgttttgtggtgactgtggtttggttatgtctgggggttctggccttgggt |
47651198 |
T |
 |
| Q |
119 |
ctttagctctctagcagtttggtgcaggtttttactggtgtcgcaatatcaaagttagtgtaatgttcggtttaagtatctctatgtgtctgtgct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47651197 |
ctttagctctctagcagtttggtgcaggtttttactggtgtcgcaatatcaaagttagtgtaatgttcggtttaagtatctctatgtgtcggtgct |
47651102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 20 - 71
Target Start/End: Complemental strand, 93066 - 93015
Alignment:
| Q |
20 |
ctaaaaggggaagaattaagtattaatgtaacaaatttgtccgtttaatgtt |
71 |
Q |
| |
|
||||||||| ||||||| | |||||||||||||||||||| |||||||||| |
|
|
| T |
93066 |
ctaaaagggaaagaattgggaattaatgtaacaaatttgtctgtttaatgtt |
93015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University