View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11059_low_9 (Length: 309)
Name: NF11059_low_9
Description: NF11059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11059_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 5e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 163 - 302
Target Start/End: Original strand, 42121594 - 42121731
Alignment:
| Q |
163 |
ttacagtcttgttattatgattgtaacattataaagattcgttggtgcttccacccagcagcatatcacgattccacattgctacctctttgtactacat |
262 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |||||||||||| ||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
42121594 |
ttacagtcttgttattatgatggtaacattataaagattcattggtgcttccatgcagcagcatatcacgattccaaattgctgcctctttgtactac-- |
42121691 |
T |
|
| Q |
263 |
attctcccaccaattctcatgtatatatatgttcatctca |
302 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42121692 |
attctcccaccaattttcatgtatatatatgttcatctca |
42121731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 41 - 143
Target Start/End: Original strand, 42121392 - 42121494
Alignment:
| Q |
41 |
aaaatcagtttgattggtgaactttcatagcaaacaggtaaagccagagacacaccaaataacctctgaaagaagagtcaatattcacaaaagattgtat |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
42121392 |
aaaatcagtttgattggtgaactttcatagtaaacaggtaaagccacggacataccaaataacctctgaaagaatattgaatattcacaaaagattgtat |
42121491 |
T |
|
| Q |
141 |
att |
143 |
Q |
| |
|
||| |
|
|
| T |
42121492 |
att |
42121494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University