View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11060_high_3 (Length: 318)
Name: NF11060_high_3
Description: NF11060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11060_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 2 - 264
Target Start/End: Complemental strand, 4065317 - 4065061
Alignment:
| Q |
2 |
gtggagaagggggtgtgggtagtgaaagtgggagtgggagtgggaatagtaataatctagtggaggtttttgtgcaaggtgttggtggtgaaagtttgat |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4065317 |
gtggagaagggggtgtgggtagtgaaagtgggagtggga------atagtaataatctagtggaggtttttgtgcaaggtgttggtggtgaaagtttgat |
4065224 |
T |
|
| Q |
102 |
aagaactagttctttaactactcgtgttggtggacttggtttgaatggtgaaaaggaattggatcaagttgttcctccttcaccacaaggtggtggtggt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4065223 |
aagaactagttctttaactactcgtgttggtggacttggtttgaatggtgaaaaggaattggatcaagttgttcctccttcaccacaaggtggtggtggt |
4065124 |
T |
|
| Q |
202 |
tcaattggttcttcttctggtacttcagaatctgagggtcaacaacatggtcaaggtaaatga |
264 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4065123 |
tcaattggttcttcttcgggtacttcagaatctgagggtcaacaacatggtcaaggtaaatga |
4065061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University