View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11060_high_7 (Length: 231)
Name: NF11060_high_7
Description: NF11060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11060_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 179
Target Start/End: Complemental strand, 27143370 - 27143191
Alignment:
| Q |
1 |
tatcactatttttgctcattcttgtcaatcgctgat-cgcaaaatatagtgtgtttgttaacactatagagcgccacaataacggctatttgacaacatt |
99 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27143370 |
tatcactatttttgctcattcttgtcgatcgctgatgcgcaaaatatagtgtgtttgttgacactatagagcgccacaataacggctatttgacaacatt |
27143271 |
T |
 |
| Q |
100 |
gtactaaatagcggatcacgacacaatagtgattgataaaattttgcgatgctatcgcgctatataacaaccctgctctt |
179 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| | ||||||||| |||||||| |||||||||||||||||| |||| |
|
|
| T |
27143270 |
gtactaaatagcggatcatgacacaatagtgattgttcaaattttgctatgctatcacgctatataacaaccctgatctt |
27143191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 69 - 133
Target Start/End: Original strand, 26445502 - 26445568
Alignment:
| Q |
69 |
agcgccacaataacggctatttgacaaca--ttgtactaaatagcggatcacgacacaatagtgatt |
133 |
Q |
| |
|
|||||||| ||||| ||||||||||||| ||||||||||||| ||||||||| |||| ||||||| |
|
|
| T |
26445502 |
agcgccactataactgctatttgacaacgctttgtactaaatagtggatcacgaaacaaaagtgatt |
26445568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 73 - 116
Target Start/End: Complemental strand, 34417405 - 34417360
Alignment:
| Q |
73 |
ccacaataacggctatttgacaaca--ttgtactaaatagcggatc |
116 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34417405 |
ccacaatagcggctatttgacaacactttgtactaaatagcggatc |
34417360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University