View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11061_high_10 (Length: 337)
Name: NF11061_high_10
Description: NF11061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11061_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 77; Significance: 1e-35; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 132 - 244
Target Start/End: Complemental strand, 33281497 - 33281385
Alignment:
| Q |
132 |
tggtccgtttattccattcttgcttgaagcttgcgatgatgaatgttcagatgttcgacaggttctcatctttggtttatactttatattaattttgctt |
231 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||| ||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
33281497 |
tggttcgtttcttccattcttgcttgaagcttgcaatgatgagtgttcagatgttcgacaggttcccatctttggtttatactttatattaccgttgctt |
33281398 |
T |
 |
| Q |
232 |
ttataattttgtt |
244 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
33281397 |
ttagaattttgtt |
33281385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 227 - 316
Target Start/End: Complemental strand, 33281367 - 33281280
Alignment:
| Q |
227 |
tgcttttataattttgttatttaactgaggtccgcaaattttctcaaagcaaaaattgaatatgttcccaggcagctgtttatggggttg |
316 |
Q |
| |
|
|||||||| ||||||||||||||| |||||| | |||||||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
33281367 |
tgcttttagaattttgttatttaa-tgaggtgcacaaattttctcaaagcaaaa-ttgaatatcttctcaggcagctgtttatggggttg |
33281280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 239 - 307
Target Start/End: Complemental strand, 39639010 - 39638942
Alignment:
| Q |
239 |
tttgttatttaactgaggtccgcaaattttctcaaagcaaaaattgaatatgttcccaggcagctgttt |
307 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||||||||||||||||||| ||| ||||||| ||||| |
|
|
| T |
39639010 |
tttgttatttaagtgaggtacacaaattttctcaaagcaaaaattgaatatcttctcaggcaggtgttt |
39638942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 143 - 196
Target Start/End: Complemental strand, 39639070 - 39639017
Alignment:
| Q |
143 |
ttccattcttgcttgaagcttgcgatgatgaatgttcagatgttcgacaggttc |
196 |
Q |
| |
|
||||||| ||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
39639070 |
ttccattattgcttgaagcttgcaatgatcaatgttcagatgttcgagaggttc |
39639017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University