View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11061_high_10 (Length: 337)

Name: NF11061_high_10
Description: NF11061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11061_high_10
NF11061_high_10
[»] chr7 (4 HSPs)
chr7 (132-244)||(33281385-33281497)
chr7 (227-316)||(33281280-33281367)
chr7 (239-307)||(39638942-39639010)
chr7 (143-196)||(39639017-39639070)


Alignment Details
Target: chr7 (Bit Score: 77; Significance: 1e-35; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 132 - 244
Target Start/End: Complemental strand, 33281497 - 33281385
Alignment:
132 tggtccgtttattccattcttgcttgaagcttgcgatgatgaatgttcagatgttcgacaggttctcatctttggtttatactttatattaattttgctt 231  Q
    |||| ||||| ||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |||||||||||||||||||||||||   ||||||    
33281497 tggttcgtttcttccattcttgcttgaagcttgcaatgatgagtgttcagatgttcgacaggttcccatctttggtttatactttatattaccgttgctt 33281398  T
232 ttataattttgtt 244  Q
    ||| |||||||||    
33281397 ttagaattttgtt 33281385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 227 - 316
Target Start/End: Complemental strand, 33281367 - 33281280
Alignment:
227 tgcttttataattttgttatttaactgaggtccgcaaattttctcaaagcaaaaattgaatatgttcccaggcagctgtttatggggttg 316  Q
    |||||||| ||||||||||||||| |||||| | |||||||||||||||||||| |||||||| ||| ||||||||||||||||||||||    
33281367 tgcttttagaattttgttatttaa-tgaggtgcacaaattttctcaaagcaaaa-ttgaatatcttctcaggcagctgtttatggggttg 33281280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 239 - 307
Target Start/End: Complemental strand, 39639010 - 39638942
Alignment:
239 tttgttatttaactgaggtccgcaaattttctcaaagcaaaaattgaatatgttcccaggcagctgttt 307  Q
    |||||||||||| |||||| | ||||||||||||||||||||||||||||| ||| ||||||| |||||    
39639010 tttgttatttaagtgaggtacacaaattttctcaaagcaaaaattgaatatcttctcaggcaggtgttt 39638942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 143 - 196
Target Start/End: Complemental strand, 39639070 - 39639017
Alignment:
143 ttccattcttgcttgaagcttgcgatgatgaatgttcagatgttcgacaggttc 196  Q
    ||||||| ||||||||||||||| ||||| ||||||||||||||||| ||||||    
39639070 ttccattattgcttgaagcttgcaatgatcaatgttcagatgttcgagaggttc 39639017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University