View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11061_low_22 (Length: 217)
Name: NF11061_low_22
Description: NF11061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11061_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 20 - 200
Target Start/End: Complemental strand, 15557797 - 15557617
Alignment:
| Q |
20 |
aggaataaaaaacatttgaagagaaacaagtgagaatattttcgtgagttaacaaattcaatggtctttccaaaaattattcttaccactttgcgaaata |
119 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15557797 |
aggaataaaaaacatttgaagagcaacaagtgagaatattttcgtgagttaacaaattcaatggtctttccaaaaattattcttaccactttgcgaaata |
15557698 |
T |
 |
| Q |
120 |
gatatggtctgagttaaactaatatcatgatcacaaatcgaacatctaatgaaatgattggttgaagataagtatatgtat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15557697 |
gatatggtctgagttaaactaatatcatgatcacaaatccaacatctaatgaaatgattggttgaagataagtatatgtat |
15557617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University