View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11061_low_23 (Length: 213)
Name: NF11061_low_23
Description: NF11061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11061_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 84; Significance: 4e-40; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 114 - 197
Target Start/End: Complemental strand, 32539254 - 32539171
Alignment:
| Q |
114 |
catgaggccaagatcatgaccactacgatttattatgccttgttgtcttattgtatgttctttgtcttattgtgatgaaattat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32539254 |
catgaggccaagatcatgaccactacgatttattatgccttgttgtcttattgtatgttctttgtcttattgtgatgaaattat |
32539171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 16 - 85
Target Start/End: Complemental strand, 32539321 - 32539252
Alignment:
| Q |
16 |
aagaattataagtagtatctaatgcattttaatggtgaactataacataactctctcacattattttcat |
85 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32539321 |
aagaattataagtagcatctaatgcatattaatggtgaactataacataactctctcacattattttcat |
32539252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University