View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11062_low_5 (Length: 254)
Name: NF11062_low_5
Description: NF11062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11062_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 18 - 147
Target Start/End: Original strand, 55071534 - 55071665
Alignment:
| Q |
18 |
attccttaatatagtactcttaggattgatgtttgtggggtattcttcaatttaaaaaccattgcacagagatgatccgtacac--ataagtacagcacg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
55071534 |
attccttaatatagtactcttaggattgatgtttgtggggtattcttcaatttaaaaaccattgcacagagatgatccgtacacatataagtacagcacg |
55071633 |
T |
 |
| Q |
116 |
tttgtcagacaactcatgcatgttctgttccc |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
55071634 |
tttgtcagacaactcatgcatgttctgttccc |
55071665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 186 - 244
Target Start/End: Original strand, 55071704 - 55071762
Alignment:
| Q |
186 |
gcatcatatacttggctttactttgaatggactaaataatctcgcattgccagtctctg |
244 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
55071704 |
gcatcatatacttggctttactatgaatggactaaataatctcgcattgccagtttctg |
55071762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University