View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11062_low_6 (Length: 210)
Name: NF11062_low_6
Description: NF11062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11062_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 13 - 194
Target Start/End: Original strand, 8180423 - 8180617
Alignment:
| Q |
13 |
gagatgaaaactaaaccaacgcctgaccaaattattcaacctatattgtatatat-------------caatgatgatcttaagatatgtggcatactca |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8180423 |
gagatgaaaactaaaccaacgcctgaccaaattatcctacctatattgtatatattaagacatgcctacaatgatgatcttaagatatgtggcatactca |
8180522 |
T |
 |
| Q |
100 |
taagagtcaactttagtattaactatatttatatacatcacttttggggctgttttgccttctgtttggtgttggtggctgactgctcatacaac |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8180523 |
taagagtcaactttagtattaactatatttatatacatcacttttggggctgttttgccttctgtttggtgttggtggctgactgctcgtacaac |
8180617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University