View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11063_high_7 (Length: 229)
Name: NF11063_high_7
Description: NF11063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11063_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 31 - 210
Target Start/End: Complemental strand, 36784759 - 36784580
Alignment:
| Q |
31 |
ctatagaaccaaaagggtattgttggaatgcattggatagttctatatttgttattttgctcaaaaatatatccgtactacttaggcacattcagagtac |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36784759 |
ctatagaaccaaaagggtattgttggaatgcattggatagttctatatttgttattttgctcaaaaatatatccgtactacttaagcacattcagagtac |
36784660 |
T |
 |
| Q |
131 |
agagaaaaattgattgccggtgctgcaagataataaacagctacaaactaggttaagcttctcttttatgagttggcttt |
210 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36784659 |
agagagaaattgattgccggtgctgcaagataataaacagctacaaactaggttaagcttctcttttttgagttggcttt |
36784580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University