View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11064_low_2 (Length: 229)
Name: NF11064_low_2
Description: NF11064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11064_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 22 - 211
Target Start/End: Original strand, 7908340 - 7908538
Alignment:
| Q |
22 |
atggtgctggctcggaagaagagaaagaatcagcgtggaaagtagttattgagtttctccggcagaaggaggcagttccgttggataattttttgaag-- |
119 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7908340 |
atggtgctggttcggaagaagagaaagaatcggcgtggaaagtagttattgagtttctccggcagaaggaggcagttccgttggataattttttgaagat |
7908439 |
T |
|
| Q |
120 |
-------ggtatcaaagagcaatatgaaagtatcagagatgatatgcaaatagcggaggatagagtgaaatgtctccaaaacattctgcaggtccgttt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7908440 |
tttgaggggtatcaaagagcaatatgaaagtatcagagatgatatgcaaatagcggaggatatagtgaaatgtctccaaaacattctgcaggtccgttt |
7908538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University