View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11066_high_8 (Length: 358)
Name: NF11066_high_8
Description: NF11066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11066_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 4e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 222 - 354
Target Start/End: Complemental strand, 28987019 - 28986887
Alignment:
| Q |
222 |
atgattgaatttgactggtttttaaattaccaaacatatttttacaatagaacttaaacataaatagattgcattagaatggttgcttggcaatccggct |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28987019 |
atgattgaatttgactggtttttaaattaccaaacatatttttacaatagaacttaaacattaatagattgcattagaatggttgcttggcaatccggct |
28986920 |
T |
 |
| Q |
322 |
cagtttatgtttaggctagcatctctgcttctc |
354 |
Q |
| |
|
|||||||||||||| |||||||| || ||||| |
|
|
| T |
28986919 |
cagtttatgtttagagtagcatctatggttctc |
28986887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 28987239 - 28987056
Alignment:
| Q |
18 |
aacaaaatagcgtggtttttggatgtccacaggccaggggtctatctatagtcaaaatctgaannnnnnnnnnnn-cagttagtatataaaatgaaatag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28987239 |
aacaaaatagcgtggtttttggatgtccacaggccaggggtctatctatagtcaaaatctgaatttttgtgtttttcagttagtatataaaatgaaatag |
28987140 |
T |
 |
| Q |
117 |
aaggaagacnnnnnnn-gacagatcagaagcaaagaccatatacgtccgaattgataattcttgatgtaatatgttccatttcg |
199 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28987139 |
aaggaagacttttttttgacagatcagaagcaaagaccatatacgtccgaattgataattcttgatgtaatatgttccatttcg |
28987056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University