View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11066_low_10 (Length: 273)
Name: NF11066_low_10
Description: NF11066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11066_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 40854106 - 40853851
Alignment:
| Q |
1 |
atgcagaaaaataattaattcttgtgagactgacatattgacgaatcgaattacacattttgaaatttccgctttttgatnnnnnnnnnnnnnnnnnnnt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40854106 |
atgcagaaaaataattaattcttgtgagactgacatattgacgagtcgaattacacattttgaaatttccgctttttgataaaaaagaaagaaaagaaat |
40854007 |
T |
|
| Q |
101 |
gcatgcagggtttgtacggtgaagtgtggtcaaggaactctgatttccacaaccttccaatgtaaattcaaaaccaaacatgcattacatgaaaaaagac |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40854006 |
gcatgcagggtttgtacggtgaagtttggtcaaggaactctgatttccacaaccttccaatgtaaattcaaaaccaaacatgcattacatgaaaaaagac |
40853907 |
T |
|
| Q |
201 |
atacagaaatcagtaaaccgtttcttcggcaagtgcagaaactcagcatactcttg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40853906 |
atacagaaatcagtaaaccgtttcttcggcaagtgcagaaactcagcatactcttg |
40853851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University