View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11066_low_12 (Length: 237)
Name: NF11066_low_12
Description: NF11066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11066_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 37863702 - 37863479
Alignment:
| Q |
1 |
cttatacttgcatttctgattgtaaagagnnnnnnnngaaaacgtgtattgtacgatgaaaatattattagcctttagatatttataaaccaaactttaa |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37863702 |
cttatacttgtatttctgattgtaaagagaaaaaaa-gaaaacgtgtattgtacgatgaaaatattattagcctttagatatttataaaccaaactttaa |
37863604 |
T |
|
| Q |
101 |
ttggaatatatactttgtactactactaatgttcataaaatcggagcggaccgttgattttatcttagttacattggtcaagtagtttaataactataaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
37863603 |
ttggaatatatactttgtactactactaatgttcataaaatcggagcggaccgttgattttatcttagttatattggtcaagtagtttaataattataaa |
37863504 |
T |
|
| Q |
201 |
ttcacctcttataagatgaagaaat |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
37863503 |
ttcacctcttataagatgaagaaat |
37863479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University