View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11068_high_11 (Length: 238)
Name: NF11068_high_11
Description: NF11068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11068_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 79 - 223
Target Start/End: Original strand, 32965169 - 32965313
Alignment:
| Q |
79 |
catcgagatatctcaacacacataaccattgtgccacacaccactttttcatacatgtatacattacctgtttggtaatttagctatatcttgttttaca |
178 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32965169 |
catcgagatacctcaacacacataaccattgtgccacacaccagtttttcatacatgtatacattacttgtttggtaatttagctatatcttgttttaca |
32965268 |
T |
 |
| Q |
179 |
gaggtgactggagtgttgattaatgggttagtcgaagcagaattc |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32965269 |
gaggtgactggagtgttgattaatgggttagtcgaagcagaattc |
32965313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University