View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11068_high_3 (Length: 510)
Name: NF11068_high_3
Description: NF11068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11068_high_3 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 9e-62; HSPs: 10)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 9e-62
Query Start/End: Original strand, 96 - 220
Target Start/End: Original strand, 14044493 - 14044617
Alignment:
| Q |
96 |
tatgatatatttttccatgaaatctgcaatgaatgagttcctaatcttctactaacagagtgtgaaaaaatgccaagtactaactccctccctaaagata |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14044493 |
tatgatatatttttccatgaaatctgcaatgaatgagttcctaatcttctactaacagagtgtgaaaaaatgcaaagtactaactccctccctaaagata |
14044592 |
T |
 |
| Q |
196 |
ttattgccattctttctaaacagag |
220 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
14044593 |
ttattgccattctttctaaacagag |
14044617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 235 - 316
Target Start/End: Original strand, 13930401 - 13930482
Alignment:
| Q |
235 |
aaagttgcaaacagagtgcaaaacaaattctacattaacgatagattcttacatgttgtgttaagttttactctcatgtata |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13930401 |
aaagttgcaaacagagtgcaaaacaaattctacattaacgataggttcttacatgttgtgttaagttttactctcatgtata |
13930482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 14 - 94
Target Start/End: Original strand, 14044249 - 14044329
Alignment:
| Q |
14 |
gaaacagacggaggctacggcgccaccgcaaatagttcgtcacatagcggtggataacaagacagtctgtcacaaactaca |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14044249 |
gaaacagacggaggctacggcgccaccgcaaatagttcgtcacatagatgtggataacaagacagtctgtcacaaactaca |
14044329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 415 - 510
Target Start/End: Original strand, 14020191 - 14020286
Alignment:
| Q |
415 |
ttggctgtctttatcgcttctaatgttgatgcggtagattcattacctgaagtctgcacttgagttttagacgaacctttgatagtaatgacagac |
510 |
Q |
| |
|
|||||||||||| ||| |||| |||||| || |||| |||||||||||||||| ||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
14020191 |
ttggctgtctttgtcgattctcatgttgttgtggtatattcattacctgaagtatgcacttgagttttagatgaacctttgatagtaacgacagac |
14020286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 442 - 510
Target Start/End: Complemental strand, 13475905 - 13475837
Alignment:
| Q |
442 |
gatgcggtagattcattacctgaagtctgcacttgagttttagacgaacctttgatagtaatgacagac |
510 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
13475905 |
gatgtggtagattcattacctgaagtctgcacttgagttttagatgaacctttgatagtaatgatagac |
13475837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 14 - 92
Target Start/End: Original strand, 13930070 - 13930147
Alignment:
| Q |
14 |
gaaacagacggaggctacggcgccaccgcaaatagttcgtcacatagcggtggataacaagacagtctgtcacaaacta |
92 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13930070 |
gaaacagacggaggcggcggcgccaca-caaatagttcgtcacatagcggtggataataagacagtctgtcacaaacta |
13930147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 259 - 300
Target Start/End: Original strand, 14044622 - 14044663
Alignment:
| Q |
259 |
aaattctacattaacgatagattcttacatgttgtgttaagt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14044622 |
aaattctacattaacgatagattcttacatgttgtgttaagt |
14044663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 235 - 285
Target Start/End: Complemental strand, 13476342 - 13476292
Alignment:
| Q |
235 |
aaagttgcaaacagagtgcaaaacaaattctacattaacgatagattctta |
285 |
Q |
| |
|
||||||||| ||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
13476342 |
aaagttgcagacagagtgcgaaaccaattctacattaacgatagattctta |
13476292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 116 - 173
Target Start/End: Original strand, 13930348 - 13930405
Alignment:
| Q |
116 |
aatctgcaatgaatgagttcctaatcttctactaacagagtgtgaaaaaatgccaagt |
173 |
Q |
| |
|
||||||||||||||||| || |||||||| |||||||||| |||||||||||| |||| |
|
|
| T |
13930348 |
aatctgcaatgaatgagctcttaatcttccactaacagagagtgaaaaaatgcaaagt |
13930405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 327 - 379
Target Start/End: Complemental strand, 13476285 - 13476233
Alignment:
| Q |
327 |
agatgactgtgaactttgaagatgtatcacggaagaagataaaaatgtattac |
379 |
Q |
| |
|
||||||| || | ||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
13476285 |
agatgacagtaatctttgaagatgtaccacggaaaaagataaaaatgtattac |
13476233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 457 - 510
Target Start/End: Original strand, 24786856 - 24786909
Alignment:
| Q |
457 |
ttacctgaagtctgcacttgagttttagacgaacctttgatagtaatgacagac |
510 |
Q |
| |
|
||||||| ||||| |||||| |||||| | |||| ||||||||||||||||||| |
|
|
| T |
24786856 |
ttacctgcagtctacacttgcgttttatatgaacatttgatagtaatgacagac |
24786909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University