View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11068_low_10 (Length: 283)
Name: NF11068_low_10
Description: NF11068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11068_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 8 - 267
Target Start/End: Original strand, 3878952 - 3879211
Alignment:
| Q |
8 |
gagcagagacctcaacaatttcaacctagctccagctttaacaatatgatgccacctccagctgctcatttgatttctccgagattgtacaataatgatc |
107 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3878952 |
gagcagggacctcaacaatttcaacctagctccagctttaacaatatgatgccacctccagctgctcatttgatttctccgagattgtacattaatgatc |
3879051 |
T |
|
| Q |
108 |
accttggaaatgttgctgaacaagttgatccaattttgcttgctctcatcaatggaaatggaaatgcaaataacccgaacttcttcttagggagtagttc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3879052 |
accttggaaatgttgctgaacaagttgatccaattttgcttgctctcatcaatggaaatggaaatgcaaataacccgaacttcttcttagggagtagttc |
3879151 |
T |
|
| Q |
208 |
aatgtaattgtaaagatgcatattttcaattttgaatgattatcttgtgattattgtttt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3879152 |
aatgtaattgtaaagatgcatattttcaattttgaatgattatcttgtgattattgtttt |
3879211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University