View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11068_low_11 (Length: 268)
Name: NF11068_low_11
Description: NF11068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11068_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 18 - 246
Target Start/End: Original strand, 53174858 - 53175086
Alignment:
| Q |
18 |
atctcagatattggaattgaaaggatgcggatgattgcggggtagcttaaacatttttatcacttcaattcctcttcgaccaattcaagatagaaggtta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53174858 |
atctcagatattggaattgaaaggatgcggatgattgcggggtagcttaaacattgttatcacttcaattcctcttcgaccaattcaagatagaaggtta |
53174957 |
T |
|
| Q |
118 |
cacatcaaatgtggccattttatttggactgatgtggaaatgtagcaaaaatatagctaaatccgaatatatgacaaatacttgttgtacatagttggcc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
53174958 |
cacatcaaatgtggccattttatttggactgatgtggaaatgtagcaaaaatatagctaaatccgaatatatgacgaatacttgttgtacatagttggcc |
53175057 |
T |
|
| Q |
218 |
tattgctagaatgacaggaaggatacata |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
53175058 |
tattgctagaatgacaggaaggatacata |
53175086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University