View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11068_low_15 (Length: 247)
Name: NF11068_low_15
Description: NF11068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11068_low_15 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 42 - 247
Target Start/End: Complemental strand, 50392343 - 50392134
Alignment:
| Q |
42 |
atagcaatatcactcataacaaacctttcactagaaaggcttattgttgaacacccataatattatttattgtggagtttcttgatgtgagagagcaata |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50392343 |
atagcaatatcactcataacaaacctttcactagaaaggcttattgttgaacacccataatattatttattgtggagtttcttgatgtgagagagcaata |
50392244 |
T |
 |
| Q |
142 |
tccatgatcctgatgatattttcatattagagaaaacattcattgaatgaaaaacaatagaataaatgg----tagcaaacaacaaagatagaatgaaga |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50392243 |
tccatgatcctgatgatattttcatattagagaaaacattcattgaatgaaaaagaatagaataaatggtagctagcaaacaacaaagatagaatgaaga |
50392144 |
T |
 |
| Q |
238 |
ggatgataat |
247 |
Q |
| |
|
|||||||||| |
|
|
| T |
50392143 |
ggatgataat |
50392134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University