View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_high_13 (Length: 357)
Name: NF11069A_high_13
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 21 - 273
Target Start/End: Complemental strand, 13669681 - 13669429
Alignment:
| Q |
21 |
caatatcattgttaacagcagcaagcaatggaatagctgtcaatcttctcactgacttgaacttgaaaacatcaatcattgatttccattgcatcatgtt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13669681 |
caatatcattgttaacagcagcaagcaatggaatagctgttaatcttctcactgacttgaacttgaaaacatcaatcattgatttccattgcatcatgtt |
13669582 |
T |
 |
| Q |
121 |
actttccttccaacctaattttccctccaccggtggtgaattctccgatgagtacgaggagaaactgctgcttccactattgtctgactctgttcctgaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13669581 |
actttccttccaacctaattttccctccaccggtggtgaattctccgatgagtacgaggagaaactgctgcttccactattgtctgactctgttcctgaa |
13669482 |
T |
 |
| Q |
221 |
acaggggcatctagtattgctcttggtgatgcttcatcgtcgcttgaaaactg |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13669481 |
acaggggcatctagtattgctcttggtgatgcttcatcgtcgcttgaaaactg |
13669429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University