View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11069A_high_24 (Length: 263)

Name: NF11069A_high_24
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11069A_high_24
NF11069A_high_24
[»] chr3 (1 HSPs)
chr3 (28-263)||(43953621-43953856)


Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 28 - 263
Target Start/End: Complemental strand, 43953856 - 43953621
Alignment:
28 agcctcactgttggagacatctttgctagtctccttgcctttttgccaacagcatgggcaattataatggtacttgtttattaaccaccaccttttgttg 127  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43953856 agcctcactgttggagacatctttgctagtctccttgcctttttgccaacagcatgggcaattataatggtacttgtttattaaccaccaccttttgttg 43953757  T
128 gatagatatgtctcattggatccatccgaatatgcacttgtttgtgtccaacacaatttgacttaagttagtccgtccatgaatttctcttggcacttgt 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43953756 gatagatatgtctcattggatccatccgaatatgcacttgtttgtgtccaacacaatttgacttaagttagtccgtccatgaatttctcttggcacttgt 43953657  T
228 ttagtagccgctgccattaaaccacactcaggcttg 263  Q
    ||||||||||| |||||||||||||| |||||||||    
43953656 ttagtagccgccgccattaaaccacattcaggcttg 43953621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University