View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_high_24 (Length: 263)
Name: NF11069A_high_24
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_high_24 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 28 - 263
Target Start/End: Complemental strand, 43953856 - 43953621
Alignment:
| Q |
28 |
agcctcactgttggagacatctttgctagtctccttgcctttttgccaacagcatgggcaattataatggtacttgtttattaaccaccaccttttgttg |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953856 |
agcctcactgttggagacatctttgctagtctccttgcctttttgccaacagcatgggcaattataatggtacttgtttattaaccaccaccttttgttg |
43953757 |
T |
 |
| Q |
128 |
gatagatatgtctcattggatccatccgaatatgcacttgtttgtgtccaacacaatttgacttaagttagtccgtccatgaatttctcttggcacttgt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953756 |
gatagatatgtctcattggatccatccgaatatgcacttgtttgtgtccaacacaatttgacttaagttagtccgtccatgaatttctcttggcacttgt |
43953657 |
T |
 |
| Q |
228 |
ttagtagccgctgccattaaaccacactcaggcttg |
263 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
43953656 |
ttagtagccgccgccattaaaccacattcaggcttg |
43953621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University