View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_120 (Length: 278)
Name: NF11069A_low_120
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_120 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 25 - 234
Target Start/End: Original strand, 9574691 - 9574900
Alignment:
| Q |
25 |
aagagatatttgatcttgtaaatgtcaggtattgcaaagatcaagcgaggttatgatattatgttggatcttcataggagtttcttgaagaaccactgag |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||| | |||||||||| ||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
9574691 |
aagagatatttgatcttgtaaatgtcaggtactacaatgctcaagcgaggctatgatattatgttggatcttcataggggtttcatgaagaaccactgag |
9574790 |
T |
|
| Q |
125 |
ttttgcctttgtattcacatgtgtgggtgatgacttgccagcagacatacatgtgtgctcaataacttcctctgcatatttattttgagaaagaaaaata |
224 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9574791 |
ttttgcctttgtattcacatgtatgggtgatgacttgccagtagacatacatgtgtgctcaataacttcctctgcatatttattttgagaaagaaaaata |
9574890 |
T |
|
| Q |
225 |
actggacggg |
234 |
Q |
| |
|
|||||||||| |
|
|
| T |
9574891 |
actggacggg |
9574900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University