View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_122 (Length: 277)
Name: NF11069A_low_122
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_122 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 25 - 222
Target Start/End: Original strand, 38483684 - 38483881
Alignment:
| Q |
25 |
tatttttggagtaagaggtgttttgagaaattgaaatggcctattgatatcgggagtagttttttcgatggaaatcgtgttgggaagacaggttttgttg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38483684 |
tatttttggagtaagaggtgttttgagaaattgaaatggcctattgatattgggagtagttttttcgatggaaatcgtgttgggaagacgggttttgttg |
38483783 |
T |
|
| Q |
125 |
aacggaggtcgttttggaatttgtttaggagttttgataggctttgggtgatgttgattttgtttcttcaagtggcgattattgttggttggaatgat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38483784 |
aacggaggtcgttttggaatttgtttaggagttttgataggctttgggtgatgttgattttgtttcttcaagtggcgattattgttggttggaatgat |
38483881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 196
Target Start/End: Original strand, 30118163 - 30118257
Alignment:
| Q |
102 |
tgttgggaagacaggttttgttgaacggaggtcgttttggaatttgtttaggagttttgataggctttgggtgatgttgattttgtttcttcaag |
196 |
Q |
| |
|
|||||| ||||| || |||||||| | ||| |||||||||||| ||||| |||||||||| ||||||||| | |||||| | ||||||||||||| |
|
|
| T |
30118163 |
tgttggtaagaccggatttgttgagcagagatcgttttggaatctgtttcggagttttgacaggctttggattatgttggtgttgtttcttcaag |
30118257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 25 - 89
Target Start/End: Original strand, 30118074 - 30118138
Alignment:
| Q |
25 |
tatttttggagtaagaggtgttttgagaaattgaaatggcctattgatatcgggagtagtttttt |
89 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||||| |||| | ||||||| |||||| |
|
|
| T |
30118074 |
tatttttggagtaggaggtgttttgagaagatgaaatggcctcctgatgttgggagtaatttttt |
30118138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University