View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_131 (Length: 266)
Name: NF11069A_low_131
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_131 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 21832005 - 21831877
Alignment:
| Q |
1 |
gatgcataatttcatgataatcagcattcgtctcttacatcaaatatggtatcaacaaaacaagttcatcttatagagatctcatcaaccacatggagtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21832005 |
gatgcataatttcatgataatcagcattcgtctcttacaccaaatatggtatcaacaaaacaagttcatcttatagagatctcatcaaccacatggagtt |
21831906 |
T |
|
| Q |
101 |
cgaacttgaaataacctgaaaatacattt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21831905 |
cgaacttgaaataacctgaaaatacattt |
21831877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 153 - 260
Target Start/End: Complemental strand, 21831854 - 21831747
Alignment:
| Q |
153 |
ctttgtagaccgataaaaacatcaatgaggacattagatctcaaacatggtattaatggagtgatcaaataccacgatcgctttcgaggagggcacttgg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21831854 |
ctttgtagaccgataaaaacatcaatgaggacattagatctcaaacatggtattaatggagtgatcaaataccacgatggctttcgaggagggcacttgg |
21831755 |
T |
|
| Q |
253 |
ataccaag |
260 |
Q |
| |
|
|||||||| |
|
|
| T |
21831754 |
ataccaag |
21831747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University