View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_135 (Length: 262)
Name: NF11069A_low_135
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_135 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 21 - 181
Target Start/End: Complemental strand, 40758474 - 40758314
Alignment:
| Q |
21 |
agttactactgcggtcttgcacaaaatttgactggattttccattgtaatattttaatgttaaatctattgaaaatagattccttgtgtatacattattc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40758474 |
agttactactgcggtcttgcacaaaatttgactggattttccattgtaatattttaatgttaaatctattgaaaatagattccttgtgtatacattattc |
40758375 |
T |
 |
| Q |
121 |
tttcggtataaataacatcagcataacagttctttcaacatcaataatatcacaatgctta |
181 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40758374 |
tttcagtataaataacatcagcataacaattctttcaacatcaataatatcacaatgctta |
40758314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University