View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_146 (Length: 254)
Name: NF11069A_low_146
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_146 |
 | |
|
| [»] scaffold0082 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0082 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: scaffold0082
Description:
Target: scaffold0082; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 23 - 91
Target Start/End: Complemental strand, 3861 - 3793
Alignment:
| Q |
23 |
ccctttatgttcttgatcttttcctccaagctctctaaattgtctaccaccttcttatgttctggcccc |
91 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3861 |
ccctttatggtcttgatcttttcctccaagctctctaaattgtctaccaccttcttatgttctggcccc |
3793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 23 - 91
Target Start/End: Original strand, 4196473 - 4196541
Alignment:
| Q |
23 |
ccctttatgttcttgatcttttcctccaagctctctaaattgtctaccaccttcttatgttctggcccc |
91 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4196473 |
ccctttatggtcttgatcttttcctccaagctctctaaattgtctaccaccttcttatgttctggcccc |
4196541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 146 - 205
Target Start/End: Original strand, 12125079 - 12125137
Alignment:
| Q |
146 |
agatgaaagagaaaagaacgatgaagatgaaagagaatgacacgagcttggtcattggtg |
205 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
12125079 |
agatgaaagagaaaagaatgatgaagatgaaagagaatgaca-gatgttggtcattggtg |
12125137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University