View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11069A_low_152 (Length: 251)

Name: NF11069A_low_152
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11069A_low_152
NF11069A_low_152
[»] chr4 (1 HSPs)
chr4 (15-207)||(54912852-54913045)
[»] chr7 (1 HSPs)
chr7 (44-102)||(11464684-11464742)
[»] chr6 (1 HSPs)
chr6 (47-79)||(7338061-7338093)


Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 15 - 207
Target Start/End: Complemental strand, 54913045 - 54912852
Alignment:
15 aacacccttttgcaaggtttactgtattgtactctcatggtaatgctgctgatttgggtcagatgcgtgacctcttcattgagcttagagctcatcttcg 114  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54913045 aacacccttttgcaaggtttactatattgtactctcatggtaatgctgctgatttgggtcagatgcgtgacctcttcattgagcttagagctcatcttcg 54912946  T
115 tatcaatatcatgaggtttcttttcttaat-ccttatatacaattttgcatgcttttattaatacaacagtttttgtctgttaattaataatta 207  Q
    | |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54912945 tgtcaatatcatgaggtttcttttcttaatcccttatatacaattttgcatgcttttattaatacaacagtttttgtctgttaattaataatta 54912852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 44 - 102
Target Start/End: Complemental strand, 11464742 - 11464684
Alignment:
44 tactctcatggtaatgctgctgatttgggtcagatgcgtgacctcttcattgagcttag 102  Q
    ||||||||||| || ||||||||| |||||||||||  ||| || ||||||||||||||    
11464742 tactctcatggcaacgctgctgatctgggtcagatgtatgagcttttcattgagcttag 11464684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 79
Target Start/End: Complemental strand, 7338093 - 7338061
Alignment:
47 tctcatggtaatgctgctgatttgggtcagatg 79  Q
    |||||||| ||||||||||||||||||||||||    
7338093 tctcatggaaatgctgctgatttgggtcagatg 7338061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University