View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_152 (Length: 251)
Name: NF11069A_low_152
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_152 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 15 - 207
Target Start/End: Complemental strand, 54913045 - 54912852
Alignment:
| Q |
15 |
aacacccttttgcaaggtttactgtattgtactctcatggtaatgctgctgatttgggtcagatgcgtgacctcttcattgagcttagagctcatcttcg |
114 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54913045 |
aacacccttttgcaaggtttactatattgtactctcatggtaatgctgctgatttgggtcagatgcgtgacctcttcattgagcttagagctcatcttcg |
54912946 |
T |
|
| Q |
115 |
tatcaatatcatgaggtttcttttcttaat-ccttatatacaattttgcatgcttttattaatacaacagtttttgtctgttaattaataatta |
207 |
Q |
| |
|
| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54912945 |
tgtcaatatcatgaggtttcttttcttaatcccttatatacaattttgcatgcttttattaatacaacagtttttgtctgttaattaataatta |
54912852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 44 - 102
Target Start/End: Complemental strand, 11464742 - 11464684
Alignment:
| Q |
44 |
tactctcatggtaatgctgctgatttgggtcagatgcgtgacctcttcattgagcttag |
102 |
Q |
| |
|
||||||||||| || ||||||||| ||||||||||| ||| || |||||||||||||| |
|
|
| T |
11464742 |
tactctcatggcaacgctgctgatctgggtcagatgtatgagcttttcattgagcttag |
11464684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 79
Target Start/End: Complemental strand, 7338093 - 7338061
Alignment:
| Q |
47 |
tctcatggtaatgctgctgatttgggtcagatg |
79 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
7338093 |
tctcatggaaatgctgctgatttgggtcagatg |
7338061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University