View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_156 (Length: 250)
Name: NF11069A_low_156
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_156 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 20 - 233
Target Start/End: Complemental strand, 23033826 - 23033608
Alignment:
| Q |
20 |
gttgcggtctttgatattgtagagaatcgtagtcaaaagctgctgatgcagcctcaattatgattgcgaagacatcgaaaatcttgatgttgcaatccaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23033826 |
gttgcggtctttgatattgtagagaatcttagtcaaaagctgctgatgcagcctcaattatgattgcgaagacatcgaaaatcttgatgttgcaatccaa |
23033727 |
T |
|
| Q |
120 |
attgcagtcaaagagttttttaaaagaaagccctgagtagatttttatgacaccaagttgctcattttgtgc-----nnnnnnnnatgtgtgtgattttc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23033726 |
attgcagtcaaagagttttttaaaagaaaaccttgagtagatttttatgacaccaagttgctcattttgtgctttttttttttttatgtgtgtgattttc |
23033627 |
T |
|
| Q |
215 |
aaatgaaatctcagttctg |
233 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
23033626 |
aaatgaaatctcagttctg |
23033608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 51 - 123
Target Start/End: Original strand, 26433741 - 26433813
Alignment:
| Q |
51 |
gtcaaaagctgctgatgcagcctcaattatgattgcgaagacatcgaaaatcttgatgttgcaatccaaattg |
123 |
Q |
| |
|
|||||||| |||||||||||||| |||| ||||| ||||||||| ||| ||| ||||||||||| ||||||| |
|
|
| T |
26433741 |
gtcaaaaggtgctgatgcagcctgtattacgattgtgaagacatcaaaagtctagatgttgcaatacaaattg |
26433813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University