View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_168 (Length: 248)
Name: NF11069A_low_168
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_168 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 20 - 248
Target Start/End: Complemental strand, 43258722 - 43258494
Alignment:
| Q |
20 |
catcagcatatcaggttttgctcaatacttggnnnnnnncttgttatggaactcgatacttgtggttgaaacttgaaacaaaacatccggctttgactgt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43258722 |
catcagcatatcaggttttgctcaatacttggtttttttcttgttatggaactcgatacttgtggttgaaacttgaaacaaaacatccggctttgactgt |
43258623 |
T |
|
| Q |
120 |
ttgctcagttataattgcacttctaaatgcatatatttgtaccgttttgcttatatgcagcatattatagcaacaccggcattagagtgctgacatatca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43258622 |
ttgctcagttataattgcacttctaaatgcatatatttgtaccgttttgcttatatgcagcatattatagcaacaccggcattaccgtgctgacatatcc |
43258523 |
T |
|
| Q |
220 |
tatgatatgcaacttataagatctgctaa |
248 |
Q |
| |
|
|||||||||||| |||||||||||||||| |
|
|
| T |
43258522 |
tatgatatgcaagttataagatctgctaa |
43258494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University