View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_169 (Length: 248)
Name: NF11069A_low_169
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_169 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 14 - 236
Target Start/End: Complemental strand, 5750390 - 5750168
Alignment:
| Q |
14 |
ctacgttaattgaccgatttaatttagagtcttcaagttcaaattagttgatttttgtgacctcttggttaatttactcatgtaataatcttggttttat |
113 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5750390 |
ctacgttaattgacaaatttaatttagagtcttcaagttcaaattagttgatttttgtgacctcttggttaatttactcatgtaataatcttggttttat |
5750291 |
T |
 |
| Q |
114 |
tatcttcgtttgttttggttagctatgttaaatactttattcttcaattttaggtgttgtgtgtatatgcatgtgcaaatggtagtatggtatatattaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5750290 |
tatcttcgtttgttttggttagctatgttaaatactttattcttcaattttaggtgttgtgtgtatatgcatgtgcaaatggtagtatggtatatattaa |
5750191 |
T |
 |
| Q |
214 |
ttgagtccaccttgatttatatt |
236 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
5750190 |
ttgagtccaccttgatttatatt |
5750168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University