View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_171 (Length: 247)
Name: NF11069A_low_171
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_171 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 9 - 235
Target Start/End: Original strand, 36162890 - 36163117
Alignment:
| Q |
9 |
gctctatcatgtgtcaacttgaatttgacccagctgtatctccttaaggtgaaacctcttgctgtccnnnnnnn-atccgtcttactgcatttaagttga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
36162890 |
gctctatcatgtgtcaacttgaatttgacccagctgtatctccttaaggtgaagcctcttgctgtccttttttttatccgtcttactgcattaaagttga |
36162989 |
T |
|
| Q |
108 |
ttaagactggccttgtatttttactaaactatctgtcttgagttcttgacaattggatgtgccttgcatttttacacgcttgttaattttgccctatttt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36162990 |
ttaagactggccttgtatttttactaaactatctgacttgagttcttgacaattggatgtgccttgtatttttacacgcttgttaattttgccctatttt |
36163089 |
T |
|
| Q |
208 |
aaactatgctgtggtataactatgtaac |
235 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
36163090 |
aaactatgctgtggtataactatgtaac |
36163117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University