View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_175 (Length: 246)
Name: NF11069A_low_175
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_175 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 86 - 246
Target Start/End: Complemental strand, 9575077 - 9574917
Alignment:
| Q |
86 |
ccacaatgggattctctcaaattattttgaccactctttatttatttatcaacatggcaatgacatcgtctatattcttttgtatgtggatgccattatt |
185 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| ||| |
|
|
| T |
9575077 |
ccacaatgggattctcttaaattattttgaccactctttatttatttatcaacatggcaatgacaccgtctatattcttttgtatgtggatgacatcatt |
9574978 |
T |
|
| Q |
186 |
cttgccgcttcttctgactctctttatgaattgattatgtctaagcttaactttgaatttt |
246 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9574977 |
cttgccgcttcttctgactatctttatgaattgattatgtctaagcttaactttgaatttt |
9574917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 89
Target Start/End: Complemental strand, 9575180 - 9575109
Alignment:
| Q |
18 |
catcatactcaactccctggccatgtctgtcttctaaaaaattctctccatggacttatacaagcaccccac |
89 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9575180 |
catcatactcaactccctggccatgtatgtcttctaaaaaattctctccatggacttatacaagcaccccac |
9575109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University