View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_183 (Length: 244)
Name: NF11069A_low_183
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_183 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 6326378 - 6326608
Alignment:
| Q |
1 |
tgtccggtgtctgtatccttatctatgcttcataggatacc-------gtatgtgctcctaaactaaatgtcttctaagtgtgtaagatctgccagagga |
93 |
Q |
| |
|
|||||||| || || |||||||| ||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6326378 |
tgtccggtatccgtgtccttatccatgcttcataggatacccccaatggtatatgctcctaaactaaatgtcttctaagtgtgtgagatctgccagagga |
6326477 |
T |
|
| Q |
94 |
taccctccgcaatccattactttagaaaccgaattggacggttcaaccacagaccttaactaaattttggcagtttgatgtgattttctctggtttgagc |
193 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6326478 |
taccctccgcaatccattactttagaagccgaattggacggttcaaccacagaccttaactaaattttggcagtttgatgtgattttctctggtttgagc |
6326577 |
T |
|
| Q |
194 |
acatcatggcctaagggactcaccggtttga |
224 |
Q |
| |
|
|||||||| |||||||| ||||||||||||| |
|
|
| T |
6326578 |
acatcatgacctaagggtctcaccggtttga |
6326608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 100
Target Start/End: Original strand, 6316994 - 6317052
Alignment:
| Q |
42 |
gtatgtgctcctaaactaaatgtcttctaagtgtgtaagatctgccagaggataccctc |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
6316994 |
gtatgtgcttctaaactaaatgtcttctaagtgtgtaccatctgtcagaggataccctc |
6317052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 163
Target Start/End: Original strand, 6317164 - 6317219
Alignment:
| Q |
108 |
cattactttagaaaccgaattggacggttcaaccacagaccttaactaaattttgg |
163 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||||||||| ||||| |
|
|
| T |
6317164 |
cattactttagaaaccgaattggacggttaaaccaacgaccttaactaaagtttgg |
6317219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 109 - 223
Target Start/End: Original strand, 6317255 - 6317379
Alignment:
| Q |
109 |
attactttagaaaccgaattggacggttcaaccacagaccttaactaaattttgg---------cagtttgat-gtgattttctctggtttgagcacatc |
198 |
Q |
| |
|
|||||||| ||||| ||||||||||||||| || ||||||||||||| ||||| ||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
6317255 |
attactttggaaacaagattggacggttcaactaccgaccttaactaaagtttggttacttaggcagtttgattgtgattttctctggtttgagcgcatc |
6317354 |
T |
|
| Q |
199 |
atggcctaagggactcaccggtttg |
223 |
Q |
| |
|
||| || ||||| ||||| ||||| |
|
|
| T |
6317355 |
atgacccaagggtttcaccagtttg |
6317379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 42 - 99
Target Start/End: Original strand, 39832752 - 39832809
Alignment:
| Q |
42 |
gtatgtgctcctaaactaaatgtcttctaagtgtgtaagatctgccagaggataccct |
99 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
39832752 |
gtatgtgcttctaaactaaatgtcttctaagtgtgtaacatctgtcagaggataccct |
39832809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University