View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_193 (Length: 243)
Name: NF11069A_low_193
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_193 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 2727701 - 2727939
Alignment:
| Q |
1 |
tataaaaaatcattaccctatcggtgcatatacggaattagatccttatagttat--ggaagtttcacgtgatacaatgcattccttcctaatccaaatg |
98 |
Q |
| |
|
||||||||||| |||| || |||||||||||||||||||| |||||||||||||| |||||||||||||| |||||| ||| ||||||||||||||||| |
|
|
| T |
2727701 |
tataaaaaatctttacactgtcggtgcatatacggaattaaatccttatagttatatggaagtttcacgtgctacaattcataccttcctaatccaaatg |
2727800 |
T |
 |
| Q |
99 |
gcaagttagggccaccaacagaattatttctagatgtcctaaggagtaaagtaccaagcaatatcaaaggaaatgccaaatttcccaaaagatcaagcaa |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
2727801 |
gcaagttagggccaccaacagaattatttctagatgtcctaaggagtaaagtaccaagcaatatcaaaggaaatgccaaatttcccaaaagatcaagtat |
2727900 |
T |
 |
| Q |
199 |
tgcaactccccaatttgtatccataggataaacaccaaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2727901 |
tgcaactccccaatttgtatccataggataaacaccaaa |
2727939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University