View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11069A_low_201 (Length: 241)

Name: NF11069A_low_201
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11069A_low_201
NF11069A_low_201
[»] chr5 (2 HSPs)
chr5 (1-71)||(29280306-29280376)
chr5 (187-228)||(29280492-29280533)


Alignment Details
Target: chr5 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 29280306 - 29280376
Alignment:
1 caacataagttcttggaccatggtactaatttggttacttttattctttttgattgagtataggaacaacc 71  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
29280306 caacataagttcttggaccatggtactaatttgtttacttttattctttttgattgagtataggaacaacc 29280376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 187 - 228
Target Start/End: Original strand, 29280492 - 29280533
Alignment:
187 cctaaaccaccagaaccatgtgtgctttttgtggatttgcat 228  Q
    ||||||||||||||||||||||| ||||||||||||||||||    
29280492 cctaaaccaccagaaccatgtgtactttttgtggatttgcat 29280533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University