View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_201 (Length: 241)
Name: NF11069A_low_201
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_201 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 29280306 - 29280376
Alignment:
| Q |
1 |
caacataagttcttggaccatggtactaatttggttacttttattctttttgattgagtataggaacaacc |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29280306 |
caacataagttcttggaccatggtactaatttgtttacttttattctttttgattgagtataggaacaacc |
29280376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 187 - 228
Target Start/End: Original strand, 29280492 - 29280533
Alignment:
| Q |
187 |
cctaaaccaccagaaccatgtgtgctttttgtggatttgcat |
228 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29280492 |
cctaaaccaccagaaccatgtgtactttttgtggatttgcat |
29280533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University