View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_205 (Length: 241)
Name: NF11069A_low_205
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_205 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 7 - 241
Target Start/End: Complemental strand, 20574684 - 20574450
Alignment:
| Q |
7 |
ccaataatcttccctacatcataaacatcagcctccacctcctgtttgttaccatgcgacaccatccaacttttccaatcatcattattagccgatagtc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20574684 |
ccaataatcttccctacatcataaacatcagcctccacctcctgtttattaccatgcgacaccatccaactttttcaatcatcattattagccgatagtt |
20574585 |
T |
|
| Q |
107 |
tggaacttgttgacaccgacacaccttcaaaattttcggacaaggcttttgacgacttactactagactttaatattttggtcctcttaaaagattgaat |
206 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
20574584 |
tggaacttgttgacacagacacaccttcaaaattttcggacaaggcttttgacgacttactactagactttaatattttggttctcttaaaagattgaat |
20574485 |
T |
|
| Q |
207 |
cacttcattcatatcccttgatgacaaccgtgcca |
241 |
Q |
| |
|
|| |||||| |||||||||||||||| ||||||| |
|
|
| T |
20574484 |
caactcattcctatcccttgatgacaatcgtgcca |
20574450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University