View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_224 (Length: 235)
Name: NF11069A_low_224
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_224 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 2677883 - 2677924
Alignment:
| Q |
19 |
cgtgattttaaattggtttattttctcaaatttattactggc |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2677883 |
cgtgattttaaattggtttattttctcaaatttattactggc |
2677924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 133 - 181
Target Start/End: Complemental strand, 2585881 - 2585832
Alignment:
| Q |
133 |
ttaaggacaagattttaaaccgtgatcacgtaa-gatccttgatactttg |
181 |
Q |
| |
|
||||| ||||| ||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
2585881 |
ttaagcacaaggttttaaatcgtgatcacgtaaggatccttgatactttg |
2585832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University