View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11069A_low_227 (Length: 234)

Name: NF11069A_low_227
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11069A_low_227
NF11069A_low_227
[»] chr7 (1 HSPs)
chr7 (8-234)||(25014566-25014792)


Alignment Details
Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 8 - 234
Target Start/End: Complemental strand, 25014792 - 25014566
Alignment:
8 tttggtgttcagataaccaggattcaatattnnnnnnnntattgatattgcggcctaaattgtagttgcaggactttttcaaattccgcggtttaaccta 107  Q
    ||||| |||| ||||||||||||||||||||        ||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||    
25014792 tttggagttcggataaccaggattcaatattaaaaaaaatattgatattgcggcctaaattgcagttgcaggtctttttcaaattccgcggtttaaccta 25014693  T
108 atgagtgaaannnnnnnggttctttaatttctctattgaggaataatgctaatgttaagtgttaaatattgcagagacaagcagatgtgaattcactaat 207  Q
    ||||||||||        |||||||||||||||||| | |||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||    
25014692 atgagtgaaatttttttagttctttaatttctctatagtggaataatgctaatgttaagtgttaaattttgcagagacaagcagacgtgaattcactaat 25014593  T
208 gctgatattggcattgttatgccattt 234  Q
    |||| | ||||||||||||||||||||    
25014592 gctgcttttggcattgttatgccattt 25014566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University