View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_230 (Length: 234)
Name: NF11069A_low_230
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_230 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 97 - 234
Target Start/End: Complemental strand, 40660096 - 40659958
Alignment:
| Q |
97 |
gtcatgctttgtgaaggttgaacttggttgttgtcctgtttggagcctatggtttacagggcatgtaggaattgggtatcagcttgatagtagtgtgcaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40660096 |
gtcatgctttgtgaaggttgaacttggttgttgtcctgtttggagcctatggtttacagggcatgtaggaattgggtatcagcttgatagtagtgtgcaa |
40659997 |
T |
|
| Q |
197 |
gccaaatgttccatgatgtgcttc-ttgttgtttgttga |
234 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40659996 |
gccaaatgttccatgatgtgcttctttgttgtttgttga |
40659958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 19 - 67
Target Start/End: Complemental strand, 40660175 - 40660127
Alignment:
| Q |
19 |
acatcactgctgcaggatttaaaaggtggtgtgtggctagtggtgcaga |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40660175 |
acatcactgctgcaggatttaaaaggtggtgtgtggctagtggtgcaga |
40660127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University