View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_232 (Length: 233)
Name: NF11069A_low_232
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_232 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 233
Target Start/End: Complemental strand, 38313838 - 38313623
Alignment:
| Q |
18 |
atattttgcatttttaactcaacctacaatctaacttatagatttaagttacatatactgttggtgtataccttttttacatgtatctaatcatatttta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38313838 |
atattttgcatttttaactcaacctacaatctaacttatagatttaagttacatgtactgttggtgtataccttttttacatgtatctaatcatatttta |
38313739 |
T |
|
| Q |
118 |
tcatatgaatatttttggagatatgtcatgaaataacctgaaaaagtagtatcatacatgatttggtttggatacaagtatagaaattttttacactctt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38313738 |
tcatatgaatatttttggagatatgtcatgaaataacctgaaaaagtagtatcatacatgatttggtttggatataagtatagaaattttttacactctt |
38313639 |
T |
|
| Q |
218 |
aacattgaaattaaat |
233 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38313638 |
aacattgaaattaaat |
38313623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University