View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_238 (Length: 231)
Name: NF11069A_low_238
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_238 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 8e-88; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 21 - 192
Target Start/End: Complemental strand, 36904218 - 36904047
Alignment:
| Q |
21 |
tttttagggttcttagtataatggtttgcttcaaaatttattagaacaatcgctttagtttgccttataaggccattatatttcagtatatgttcttgtt |
120 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36904218 |
tttttggggttcttagtataatggtttgcttcaaaatttattagaacaatcgctttagtttgccttataaggccgttatatttcagtatatgttcttgtt |
36904119 |
T |
|
| Q |
121 |
ttctttttcttttactaaatgagtatacgatcttctattatttccattgccttgtttgtttttatatatgat |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36904118 |
ttctttttcttttactaaatgagtatacgatcttctattatttccattgccttgtttgtttttatatatgat |
36904047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 65 - 177
Target Start/End: Original strand, 37073736 - 37073847
Alignment:
| Q |
65 |
aacaatcgctttagtttgccttataaggccattatatttcagtatatgttcttgttttctt-tttcttttactaaatgagtatacgatcttctattattt |
163 |
Q |
| |
|
|||||||| ||||| |||||||| |||||||||||||| |||| ||||||||| |||||| |||||||||||| ||||| |||| |||||||||||||| |
|
|
| T |
37073736 |
aacaatcgatttagcttgcctta--aggccattatatttgagtagatgttcttgctttcttctttcttttactatatgagcatacaatcttctattattt |
37073833 |
T |
|
| Q |
164 |
ccattgccttgttt |
177 |
Q |
| |
|
||||||| |||||| |
|
|
| T |
37073834 |
ccattgctttgttt |
37073847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University