View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_266 (Length: 226)
Name: NF11069A_low_266
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_266 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 3 - 220
Target Start/End: Complemental strand, 24425516 - 24425300
Alignment:
| Q |
3 |
ttttggacaacatcaaattctatcaaaaacaaagtcaaaagttcataattgtatcaatatcaacaattcaacatctaattttggacaaaaacatagccaa |
102 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24425516 |
ttttggacaacatctaattctatcaaaaacaaagtcaaaagttcataattgtatcaatatcaacaattcaacatctaattttggacaaaaacatagccaa |
24425417 |
T |
 |
| Q |
103 |
aagtccataattgtatcaatatccactttagaagcacatgacaaatagataattcatctgattatcaacaaactatcataatttaaaacaataatgcagt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24425416 |
aagtccataattgtatcaatatccactttagaagcacatgacaaatagataattcatctgattatcaac-aactatcataatttaaaacaataatgcagt |
24425318 |
T |
 |
| Q |
203 |
tgagtgggagtataattg |
220 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
24425317 |
tgagtgggagtataattg |
24425300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University