View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_289 (Length: 214)
Name: NF11069A_low_289
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_289 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 21 - 195
Target Start/End: Original strand, 11557732 - 11557906
Alignment:
| Q |
21 |
tggtctgcccagtctgggattgtacggaggagggtgattatggtttttattggggtggggggaggtgtggaagaacattttaggggggtgtgtttgtagg |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11557732 |
tggtctgcccagtctgggattgtacggaggagggtgattatggtttttattggagtggggggaggtgtggaagaacattttaggggggtgtgtttgtagg |
11557831 |
T |
|
| Q |
121 |
atttggaatatggttgaagaattagttgttggagtaggtgtgagtggcattttggagtgaattgggaagttaggt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11557832 |
atttggaatatggttgaagaattagttgttggagtaggtgtgagtggcattttggggtgaattgggaagttaggt |
11557906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University