View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_293 (Length: 210)
Name: NF11069A_low_293
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_293 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 29 - 187
Target Start/End: Original strand, 22015203 - 22015361
Alignment:
| Q |
29 |
aagcacagatcgaactattcttttgccttttactnnnnnnngaaagatgataatccagaaaaacattaactgaataaaactatgtggatagctaaaagga |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22015203 |
aagcacagatcgaactattcttttgccttttactaaaaaaagaaagatgataatccagaaaaacattaactgaataaaactatgtggatagctaaaagga |
22015302 |
T |
 |
| Q |
129 |
aaaaacatacaattggatcaggtgcattagcctgctggcacataatccagggaacacct |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22015303 |
aaaaacatacaattggatcaggtgcattagcctgctggcacataatccagggaacacct |
22015361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University