View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11069A_low_293 (Length: 210)

Name: NF11069A_low_293
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11069A_low_293
NF11069A_low_293
[»] chr4 (1 HSPs)
chr4 (29-187)||(22015203-22015361)


Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 29 - 187
Target Start/End: Original strand, 22015203 - 22015361
Alignment:
29 aagcacagatcgaactattcttttgccttttactnnnnnnngaaagatgataatccagaaaaacattaactgaataaaactatgtggatagctaaaagga 128  Q
    ||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22015203 aagcacagatcgaactattcttttgccttttactaaaaaaagaaagatgataatccagaaaaacattaactgaataaaactatgtggatagctaaaagga 22015302  T
129 aaaaacatacaattggatcaggtgcattagcctgctggcacataatccagggaacacct 187  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22015303 aaaaacatacaattggatcaggtgcattagcctgctggcacataatccagggaacacct 22015361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University