View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_295 (Length: 210)
Name: NF11069A_low_295
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_295 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 96 - 204
Target Start/End: Original strand, 26782747 - 26782855
Alignment:
| Q |
96 |
ctaacggggacacattactaatttcctgtatgtcatatataatatgtatcatcactggggacgggtagataattgatagctaaaatggttggagttactt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26782747 |
ctaacggggacacattactaatttcctgtatgtcatatataatatgtatcatcactggggacgggtagataattgatagctaaaatggttggagttactt |
26782846 |
T |
|
| Q |
196 |
aatacatga |
204 |
Q |
| |
|
||||||||| |
|
|
| T |
26782847 |
aatacatga |
26782855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University