View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11069A_low_295 (Length: 210)

Name: NF11069A_low_295
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11069A_low_295
NF11069A_low_295
[»] chr4 (1 HSPs)
chr4 (96-204)||(26782747-26782855)


Alignment Details
Target: chr4 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 96 - 204
Target Start/End: Original strand, 26782747 - 26782855
Alignment:
96 ctaacggggacacattactaatttcctgtatgtcatatataatatgtatcatcactggggacgggtagataattgatagctaaaatggttggagttactt 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26782747 ctaacggggacacattactaatttcctgtatgtcatatataatatgtatcatcactggggacgggtagataattgatagctaaaatggttggagttactt 26782846  T
196 aatacatga 204  Q
    |||||||||    
26782847 aatacatga 26782855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University