View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_301 (Length: 208)
Name: NF11069A_low_301
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_301 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 20 - 190
Target Start/End: Original strand, 31718309 - 31718475
Alignment:
| Q |
20 |
catcagatgaatgccttaaaagtgaatcgatcgatttccatgtgcctagccaccctcagtatgatattgaacttcaataactctttggtttggaaatgtt |
119 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31718309 |
catcagatgaatgccttaagagtgaatcg----atttccatgtgcctagccacccccagtatgatattgaacttcaataactctttggtttggaaatgtt |
31718404 |
T |
|
| Q |
120 |
gtaaaatctggctgttgcattggctcttgtttcaatcttttagggttgccgaagtttaagaaatattaaat |
190 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |||| |
|
|
| T |
31718405 |
gtaaaatttggctgttgcattggctcttgtttcaatcttttatggttgccgaagttaaagaaatatgaaat |
31718475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University