View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11069A_low_302 (Length: 208)
Name: NF11069A_low_302
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11069A_low_302 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 34 - 190
Target Start/End: Original strand, 36748626 - 36748782
Alignment:
| Q |
34 |
tcttgtgagcaaattccattttctaatgatgtctttgcatatccattacttttcacatccattgaacttgaatctgttttcttcttttctccaaaaccat |
133 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36748626 |
tcttgtgagcaaattccattttctgatgatgtctttgcatatccattacttttcacatccattgaacttgaacctgttttcttcttttctccaaaaccat |
36748725 |
T |
 |
| Q |
134 |
acagaacaaacacaaatgccaaactacaagccagaatccctccaagaatatactgat |
190 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36748726 |
acacaacaaacacaaatgccaaactacaagccagaatccctccaagaatatactgat |
36748782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University